☑️ EXAMENS CORRIGÉES DE BIOLOGIE MOLÉCULAIRE S5 PDF TD-SVI

Biologie Moléculaire pdf s5
ADVERTISEMENT

📚Ici vous trouverez tout QCM, contrôles et examens de Biologie Moléculaire S5 avec corrigés PDF. SVI 3ème année Licence Biologie (Sciences de la Vie)

Vous pouvez télécharger et passer des examens en ligne avec nous.

Vos commentaires nous font plaisir, n’hésitez pas de nous laisser un 😉


Examens à Télécharger en PDF

Examens scannés: Examens corrigés de Biologie Moléculaire s5 pdf semestre 5 à télécharger

Examen biologie moléculaire s5 PDF 1

Epreuve biologie moléculaire PDF 3

Examen PDF 2

Epreuve PDF 4

Epreuve PDF 5

Epreuve PDF 6

Epreuve PDF 7


Examens en Photos

Exercices (durée conseillée : 40 min)
1ère partie :
Un chercheur vient d’identifier un nouveau gène chez E. coli. Afin de vérifier la présence de ce gène dans d’autres espèces bactériennes, de l’ADN génomique de ces différentes espèces est analysé par Southern blot. L’ADN génomique d’E. coli est utilisé comme témoin positif.

La sonde utilisée pour cette expérience est isolée et amplifiée par Polymerase Chain Reaction (PCR) à partir d’ADN génomique de l’espèce témoin E. coli. Les séquences des extrémités de la sonde à amplifier sont présentées dans la figure 1. Les amorces oligonucléotidiques utilisées (20 nucléotides) sont préalablement radiomarquées à leur extrémité 5’.

Q1- A partir de la séquence ADN présentée dans la figure 1, donnez la séquence du couple
d’amorces pour amplifier par PCR la totalité de la séquence indiquée figure 1.
5’CCTAGGACTGGCTTATAGTG3’ et 5’TCTGTGAACGTGTACCTATC3’

Q2- Décrivez la méthode permettant de radiomarquer ces oligonucléotides à leur extrémité 5’ ?
Vous préciserez le nom et la fonction de(s) enzyme(s) ainsi que les réactifs nécessaires.
1) phosphatase (alcaline) pour déphosphoryler l’extrémité 5’ du fragment PCR
2) Phosphorylation des extrémités 5’ avec la PolyNucléotide Kinase (PNK) en présence d’ATP ![32P]

ADVERTISEMENT

La PCR est réalisée et le fragment d’ADN ainsi amplifié est utilisé comme sonde pour des expériences d’hybridation en Southern Blot. Après hybridation, la membrane est incubée dans différentes solutions de lavages puis autoradiographiée, un signal est obtenu, mais il est très faible, y compris pour l’ADN génomique d’E. coli (témoin positif).

Q3- Rappelez les principales étapes du Southern Blot.
Extraction de l’ADN
Hydrolyse de l’ADN par action d’une ou plusieurs enzymes de restriction
Séparation par électrophorèse sur gel d’agarose en conditions natives
Dénaturation par traitement alcalin
Transfert sur membrane de nitrocellulose
Hybridation avec sonde radiomarquée
Autoradiographie, révélation selon le marquage de la sonde

Q4- Le chercheur souhaite modifier les conditions expérimentales des lavages afin d’obtenir un signal plus fort, quel(s) paramètre(s) ce chercheur peut-il modifier et comment doit-il le(s) faire varier ? Justifiez votre réponse.

Le signal existe, mais il est trop faible. Il faut des conditions moins stringentes.
Abaisser la T° de lavage car plus la température est basse par rapport au Tm et plus les appariements sont favorisés
et/ou
Augmenter la concentration en sels car les sels neutralisent les charges négatives portées par les groupements phosphate permettant de diminuer les répulsions électrostatiques entre les brins et donc de favoriser les appariements

_CCTAGGACTGGCTTATAGTGACGCATGCGATATACTAAAG—–ACAGTAAGGCTAGACTTCGGGATAGGTACACGTTCACAGA_

Figure 1 : Séquences des extrémités du fragment d’ADN à amplifier pour la préparation de la sonde (seul le brin sens a été représenté, orientation 5’-3’). Les tirets indiquent la présence d’une séquence d’ADN non définie.

2ème partie :
La matrice décrite ci-dessous est utilisée dans un milieu réactionnel contenant le fragment de Klenow de l’ADN polymérase I et une solution tampon (pH 7,4) contenant des cations mono- et bivalents (6 tubes identiques numérotés de 1 à 6 sont préparés en parallèle).

Examen Biologie Moléculaire PDF

Les nucléotides libres indiqués dans le tableau suivant sont ajoutés, en quantités équimolaires (équivalentes), dans chacun des 6 tubes qui sont alors incubés pendant 10 minutes à 37°C (cf. tableau).

Examen Biologie Moléculaire PDF
Tableau: Nucléotides ajoutés dans chacun des six tubes

Q1- Rappelez les activités enzymatiques du fragment de Klenow de l’ADN polymérase I.
Polymérisation 5′–!3′ et exonucléase 3′–!5′.

Q2- Pour chaque mélange, donnez le nombre total de fragments d’ADN obtenus. Indiquez la séquence du brin signalé par la flèche pour chacun de ces fragments.

Examen Biologie Moléculaire PDF

Examen Biologie Moléculaire PDF
Examen Biologie Moléculaire PDF
Examen Biologie Moléculaire PDF
Examen Biologie Moléculaire PDF
Examen Biologie Moléculaire PDF

Autres Examens de S5

Contrôles de Physiologie des grandes fonctions
Contrôles de Croissance et développement des plantes
Contrôles de Immunologie
Contrôles de Génétique II
Contrôles de Ecologie Générale

ADVERTISEMENT

Laisser un commentaire

Votre adresse e-mail ne sera pas publiée.

Panier